Your Perfect Assignment is Just a Click Away
We Write Custom Academic Papers

100% Original, Plagiarism Free, Customized to your instructions!

glass
pen
clip
papers
heaphones

Southern Blot Technique to Detect the Ultrabithorax Gene

Southern Blot Technique to Detect the Ultrabithorax Gene

Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction EnzymesAbstract: The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample on an agarose gel the large sample of DNA is initially digested using restriction enzymes to provide smaller fragments of the DNA sequence. The loading dye serves as a label to detect the DNA fragments under a UV light to measure the band length of travel. In our specific experiment the Southern blot technique was used to detect the Ubx gene from the Drosophila melanogaster and pET19 – Ubx plasmid. If the restriction enzymes properly digested the the DNA from the Drosophila melanogaster fly, then under the colorimetric probe detection we are able to view and measure the band lengths to verify whether or not the Ubx gene is present in the DNA sample of interest. The experiment produced bands for the lanes loaded with the sample containing plasmid DNA, however bands for Drosophila melanogaster genomic DNA were not observed, but could potentially be due to a multitude of reasons discussed later, rather than the lack of genomic DNA being present altogether.Introduction: Edward Southern was successful in devising a method in which specific DNA sequences were detected to determine whether the sequence contained targeted genes of interest (Pattison, 2019). The Southern blot forms the basis of many different types of techniques used in the scientific community today, and although the need for using the original Southern blot technique to to single out the gene of interest in the DNA of an organism has lessened, majority of the modern day techniques are derivatives from the science behind the Southern technique.The Southern blot technique also helps detect various genes specific to diseases that in turn allow for scientists and medical professionals to help with early diagnosis and understanding of the particular disease. One such usage can be seen in the 2015 study of Facioscapulohumeral dystrophy which scientists have learned can be identified by the lower count of D4Z4 arrays (Vasale et. al, 2015). Detection of this specific gene allows for medical professionals to diagnose patients with FSHD1 (Facioscapulohumeral dystrophy). The Southern blot technique has been an essential tool in this type of diagnosis to study the contractions of this particular gene on chromosome 4 (Vasale et. al,2015). Similarly scientists have used the Southern blot technique to learn more about diseases and disorders such as the Fragile X syndrome. The number of cytosine – guanine – guanine set has been directly linked to the likelihood of this syndrome being present in a patient (Chen et. al, 2010). Although currently scientists are working on using PCR technology in hopes of attaining for accurate data in a more efficient manner, the Southern blot technique has formed the basis of the current knowledge base about the disorder. The Southern blot technique has not always remained the same in laboratories. In fact, many scientists use hybridized versions of the technique for certain studies. One such study was conducted in 2013 to study a C9ORF72 locus containing a repeated hexanucleotide expansion of GGGGCC (Buchman et. al, 2013). A hybridized Southern blot protocol was used in hope to combat the limitations presented by the basic technique and PCR protocols. The study was conducted in hope of attaining a better understanding of the gene, since its presence had previously been noted in a significant number of patients with amyotrophic lateral sclerosis (Buchman et. al 2013). The Southern blot technique forms the basis in advanced knowledge regarding the diagnosis and treatment of many diseases such as these, and through hybrid versions and techniques based off the Southern blot, the field of biology is growing its knowledge base  every year.Interestingly the Southern, northern, and western blot were created around the same timeline in history. The Southern blot being the first, provided a fundamental basis for the advancements of the northern and western blot technique. The basic differences between the three techniques would be associated with the type of detection in each blot. The Southern blot technique is used to detect DNA sequences, while the northern blot technique focuses on detecting RNA sequences and finally the western blot technique focuses on detecting protein sequences. A similarity between Southern and northern blot technique is that both use the method of capillary transfer, while on the other hand the western blot technique uses electric transfer (Mahmood, 2012). This experiment was conducted in order to understand the fundamentals behind the Southern blot technique and to detect the Ultrabithorax gene of the Drosophila melanogaster fly and the pET19b – Ubx plasmid. In order to prevent non specific binding from the probe, dried milk was used – which resulted in the specific binding of DNA sequences and the probe. It was hypothesized that the Drosophila melanogaster genomic DNA would not present bands in the lanes that contained genomic DNA because the bands are too large to present themselves on the gel. The plasmid DNA, however, was predicted to present bands in the wells loaded with this sample. Using digoxigenin helps detect the Ubx gene on the Southern blot, which can in turn allow for determination of whether or not Ubx is present.  The probe sequence that was used for the experiments is as follows:5’ CCTCTCTCGCTGGGCATGAGTCCCT 3’ The restriction enzymes that were used in this experiment are BanII, BamHI, and BanII/NdeI. The BanII was expected to cut the genomic DNA in more than one place, which would indicate that the expected band size would be smaller than the genomic DNA that was cut with BamHI. The BamHI, on the other hand, was expected to cut the DNA in only one place. And finally the NdeI was expected to cut the genomic DNA in only one place. The lane with only the BamHI was expected to cut the DNA at 6882 base pairs; the lane with only NdeI was expected to cut at 1173 base pairs; the lane with only BanII was expected to cut at 14 base pairs, 813 base pairs, 1123 base pairs, and 4932 base pairs; the lane with BamHI and NdeI was expected to cut at 1177 base pairs, and 5705 base pairs; and the lane with BanII and NdeI was expected to cut at 14 base pairs, 278 base pairs, 813 base pairs, 845 base pairs, and 4932 base pairs.Which type of enzyme is being used with pET19 – Ubx plasmid?What is the resulting expected size of the band?When using BamHIExpected band size is 6882 base pairs.When using NdeIExpected band size is 1173 base pairs.When using BanIIExpected band sizes are 14 base pairs; 813 base pairs; 1123 base pairs; and 4932 base pairs.When using NdeI and BamHIExpected band sizes are 1177 base pairs, 5705 base pairs.When using NdeI and BanIIExpected band sizes are 14 base pairs, 278 base pairs, 813 base pairs, 845 base pairs, 4932 base pairs.Table 1: These are the band sizes that can be expected when using the various different restriction enzymes to cleave pET19 – Ubx plasmid.Materials and Methods: All materials and methods were conducted according to Dr. Pattison’s protocol. The protocol is cited as follows : Pattison, D. 2015. Southern Blotting:  Detection of the Ultrabithorax (Ubx) gene of Drosophila melanogaster. Houston: University of Houston. It is important to note the probe sequence for the protocol and for this experiment the sequence was:5’CCTCTCTCGCTGGGCATGAGTCCCT 3’.Certain deviations were taken from the protocol. The wells designed for the agarose gel had smaller comb sizes, and therefore 15 µl of solution from each tube were added into the wells instead of the 20 µl stated in the protocol. Certain deviations were also made to the part of the protocol pertaining to the colorimetric probe detection method which are as follows. The protocol calls for the use of 100 ml of each type of buffer used to wash the membrane, but instead 40 ml were used to wash the membrane with Buffer I, Buffer II, and the wash buffer. Along with this, the antibody/enzyme solution (at a ratio of 1/5000 concentration) amount was lessened from 40 ml to 32 ml that were used. The agarose gel is stated to be 0.8 % in the protocol, but in the experiment we used a 1% agarose gel instead.Results: The purpose of this experiment was to detect the UBX gene in D. melanogaster using the Southern blotting technique. Figure 1 displays the results when the samples were run on a 1% agarose gel. The expected band sizes are written for lanes 5, 6, 7, and 8. Starting at land 5, there was a band at 6882 base pairs when BamHI was used to digest the pET19 UBX in lane 5. In lane 6 the band size was 1123 base pairs which contains BanII to digest pET19 UBX, 845 base pairs in lane 7 with two restriction enzymes which were BanII and NdeI. Lastly, lane 8 contained BamHI and NdeI to digest the pET19 UBX DNA which appeared at band size 1177 base pairs. The smear that formed in lanes 2-3 was expected due to the amount of DNA loaded in the wells. At the bottom of these three lanes there are RNA fragments which we don’t account for because our focus are the DNA fragments.Figure 1: Agarose gel used to load samples for agarose gel electrophoresis. Lane 1: 12 ?l Promega ladder. Lane 2: 15 ?l of content from Tube 1 which contained water, genomic DNA, CutSmart Buffer, and BamHI. Lane 3: 15 ?l of content from Tube 2 which contained water, genomic DNA, CutSmart Buffer, and BanII. Lane 4: 15 ?l of content from Tube 3 which contained water, genomic DNA, CutSmart Buffer, NdeI and BanII. Lane 5: 15 ?l of  content from Tube 4 which contained water, pET19-UBX, CutSmart Buffer, and BamHI. Lane 6: 15 ?l of content from Tube 5 which contained water, pET19-UBX, CutSmart Buffer, and BanII. Lane 7: 15 ?l of content from Tube 6 which contained water, pET19-UBX, CutSmart Buffer, NdeI, and BanII. Lastly,  lane 8: 15 ?l of content from Tube 7 which contained water, pET19-UBX, CutSmart Buffer, BamHI, and NdeI.Figure 2: Positively charged nylon membrane in which DNA was transferred to detect the location and size of the UBX gene. Lane 4 that contained NdeI and BanII restriction enzyme displayed a band at 682 base pair. Lane 5 contained BamHI enzyme which displayed a band at 1123 base pair.  Lane 7 displayed a band at 845 base pairs with enzymeDiscussion:Our predicted hypothesis was correct in that no visible bands were seen in the region of the gel where Drosophila melanogaster genomic DNA was loaded, but bands were observed in the region of the gel where plasmid DNA was loaded into the wells. After we ran the gel, there was an observable smear in lane 2, lane 3, and lane 4. Although there are no visible bands present, this does not necessarily mean no genomic DNA is present, rather the genomic DNA bands from the Drosophila melanogaster are too large to be visible on the gel.The noticeable smear on the gel could be present due to a wide array of reasons. While transferring the samples in the tubes into the wells, the protocol had directed us to add 20 ?l of the sample from the tube into the wells. Although we did this for the first and second lane, we realized that this was causing the wells to overflow and opted to deviate from the protocol and start adding 15 ?l instead. This overloading of the wells could potentially cause for the smear observed on the gel. This could potentially pose to be an issue since there is a chance that not enough DNA plasmid is being transferred into the wells from the tubes. The wells that were loaded with 20 ?l caused for an overflow and resulted in a minute immeasurable amount of sample to flow into the buffer. Since we saw bands on our membrane, it is safe to assume that DNA was present, but not in enough quantity to show bands on the gel for the lanes that contained pET19 – Ubx. The bands that were present for the pET19 – Ubx infused sample wells. The band present for the well with pET19 – Ubx and BamHI was at 6882 base pairs; the band present for the well with pET19 – Ubx and BanII was at 1177; the band present for the well with pET19 – Ubx and NdeI / BanII was at 1123 base pairs; and finally the band present for pET19 – Ubx and BamHI and NdeI was at 875 base pairs. As stated before, no visible bands were observed for the lanes that were loaded with the genomic Drosophila melanogaster DNA, but this does not necessarily equate to the fact that no DNA is present in these lanes. The bands for the Drosophila melanogaster genomic DNA are too large to be shown on the gel. To conclude, we were successful in using the Southern blot technique to detect the Ubx gene the pET19 – Ubx plasmid. With the exception of a few errors and unexpected deviations that we were forced to make while conducting the experiment, we were successful in following the protocol and being able to observe bands on our membrane. The plasmid was cleaved as expected, and the size of the base pairs were as predicted. In the future researchers could potentially design experiments based on this protocol that can help detect certain DNA fragments that are found to be common in cancer cells, and in turn could help answer some hanging questions the scientific community has regarding this disease today. References:Vasale, J., Boyar, F., Jocson, M., Sulcova, V., Chan, P., Liaquat, K., . . . Higgins, J. (2015, August 11). Molecular combing compared to Southern blot for measuring D4Z4 contractions in FSHD. Retrieved February 02, 2019.Chen, L., Hadd, A., Sah, S., Filipovic-Sadic, S., Krosting, J., Sekinger, E., . . . Latham, G. (2010, September 5). An Information-Rich CGG Repeat Primed PCR That Detects the Full Range of Fragile X Expanded Alleles and Minimizes the Need for Southern Blot Analysis. Retrieved February 3, 2019.Buchman, V., Cooper-Knock, J., Connor-Robson, N., Higginbottom, A., Kirby, J., Razinskaya, O., . . . Shaw, P. (2012, August 1). Simultaneous and independent detection of C9ORF72 alleles with low and high number of GGGGCC repeats using an optimised protocol of Southern blot hybridisation. Retrieved February 2, 2019Kimura, M., Aviv, A., Stone, R., Hunt, S., Skurnick, J., Lu, X., . . . Harley, C. (2010, September 2). Measurement of telomere DNA content by dot blot analysis. Retrieved February 2, 2019.Mahmood, T., & Yang, P. (2012, September 04). Western Blot: Technique, Theory, and Trouble Shooting. Retrieved February 15, 2019.

Order Solution Now