BIOLOGY ASSIGNMENT (DEADLINE ASAP)
1. The 3 genes that you will compare at listed below. Take a look. Ive colored the header region of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DONT FORGET TO INCLUDE THE HEADER (RED) REGION (starting with >). The > symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the white box-region just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the > symbol and red heading.
image3.png
4. Click the region below the box marked Start MultiAlin. This starts your comparison
5. Examine results. Make note of the colors. If the colors are alike that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE. SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the Start MultiAlin just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesnt matter if you dont have color printer.
11. Or at the bottom of the image page, there is a command — Results as a gif file. It is located under the region marked, AVAILABLE FILES Click on this (Results as a gif file) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue ) the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
image2
There are 3 genes below they start with the > symbol
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGCACCAGGGACTCCTGCCCGCGGCCCCCGCATGACACCCAGCGACCTGCGCAA
CCTCGACGAGCTGGTGAGGGAGATTCTGGGCCGCTGCACCTGCCCTGACCAGTTTCCCATGATCAAGGTC
TCAGAGGGGAAGTACCGTGTGGGGGACTCGAGCCTGCTCATCTTTGTGCGGGTGCTGAGGAGCCACGTGA
TGGTGCGAGTGGGTGGTGGCTGGGACACGCTGGAGCATTACCTGGACAAGCACGACCCGTGCCGCTGCTC
CTCCACTGCTCATCGCCCACCCCAGCCGAGGGTCTGCACCTTTTCTCCACAGAGGGTGTCGCCCACCACC
>gi|21961309|gb|BC034582.1| Homo sapiens keratin associated protein 3-2, mRNA (cDNA clone MGC:34106 IMAGE:3909612), complete cds
