Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.
Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes.Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.You will notice that the second strand has a point deletion (the uin bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
